TRIM Enabler 4.3

DataWeave Flatfile: Added the reader and writer property useMissCharAsDefaultForFill for the flat file format. When this property is set to true, DataWeave uses the fill character configured in the missingValues property to trim or pad elements. If useMissCharAsDefaultForFill is set to false, DataWeave uses the space character.

TRIM Enabler 4.3

Cutadapt searches for the adapter in all reads and removes it when it finds it.Unless you use a filtering option, all reads that were present in the input filewill also be present in the output file, some of them trimmed, some of them not.Even reads that were trimmed to a length of zero are output. All of this can bechanged with command-line options, explained further down.

The requirement for a full match at the beginning of the read is relaxedwhen Cutadapt searches error-tolerantly, as it does by default. Inparticular, insertions and deletions may allow reads such as these to betrimmed, assuming the maximum error rate is sufficiently high:

If you anchor an adapter, it will also become marked as being required. If arequired adapter cannot be found, the read will not be trimmed at all even ifthe other adapter occurs. If an adapter is not required, it is optional.

As described, when you specify a linked adapter with -a, the adapters that are anchoredbecome required, and the non-anchored adapters become optional. To change this, you caninstead use -g to specify a linked adapter. In that case, both adapters are required(even if they are not anchored). This type of linked adapter type is especially suited fortrimming CRISPR screening reads. For example:

Since Cutadapt allows partial matches between the read and the adapter sequencefor most adapter types, short matches can occur by chance, leading to erroneouslytrimmed bases. Forexample, just by chance, we expect that roughly 25% of all reads end with a basethat is identical to the first base of the adapter. To reduce the number offalsely trimmed bases,the alignment algorithm requires that at least three bases of the adapterare aligned to the read.

All IUPAC nucleotide codes(wildcard characters, degenerate bases) are supported.For example, use an N in the adaptersequence to match any nucleotide in the read, or use -a YACGT for an adapterthat matches both CACGT and TACGT. The wildcard character N isuseful for trimming adapters with an embedded variable barcode:

With --action=retain, the read is trimmed, but the adapter sequence itselfis not removed. Up- and downstream sequences are removed in the same way asfor the trim action. For linked adapters, both adapter sequences are kept.

If you want to update this to the correct length after trimming, use the option--length-tag. In this example, this would be --length-tag 'length='.After trimming, the read would perhaps look like this:

By default, all processed reads, no matter whether they were trimmed or not,are written to the output file specified by the -o option (or to standardoutput if -o was not provided). For paired-end reads, the second read in apair is always written to the file specified by the -p option.

The options --too-short-output and --too-long-output are applied first.This means, for example, that a read that is too long will never end up in the--untrimmed-output file when --too-long-output was given, no matterwhether it was trimmed or not.

Cutadapt supports trimming of paired-end reads. To enable this, provide twoinput files and a second output file with the -p option (this is the shortform of --paired-output). This is the basic command line syntax:

In paired-end mode, the options -a, -b, -g and -u that alsoexist in single-end mode are applied to the forward reads only. To modifythe reverse read, these options have uppercase versions -A, -B,-G and -U that work just like their counterparts.In the example above, ADAPTER_FWD will therefore be trimmed from theforward reads and ADAPTER_REV from the reverse reads.

As an exception, when you specify adapters only for R1 (-a/-g/-b) or only forR2 (-A/-G/-B), then the --pair-filter mode for --discard-untrimmed isforced to be both (and accordingly, also for the --untrimmed-(paired-)output options).

Note that the option names can be abbreviated as long as it is clear whichoption is meant (unique prefix). For example, instead of --untrimmed-outputand --untrimmed-paired-output, you can write --untrimmed-o and--untrimmed-p.

There is one limitation of the algorithm at the moment: The program looks for the best-matching R1 adapterfirst and then checks whether the corresponding R2 adapter can be found. If not, the read pairremains unchanged. However, it is in theory possible that a different R1 adapter that does notfit as well would have a partner that can be found. Some read pairs may therefore remain untrimmed.

The file: syntax can be combined with the regular way of specifying anadapter. But no matter how you specify multiple adapter sequences, rememberthat only the best matching adapter is trimmed from each read.

Cutadapt supports demultiplexing, which means that reads are written to differentoutput files depending on which adapter was found in them. To use this, includethe string name in the name of the output file and give each adaptera name.The path is then interpreted as a template and each trimmed read is writtento the path in which name is replaced with the name of the adapter thatwas found in the read. Reads in which no adapter was found will be written to afile in which name is replaced with unknown.

As an example for how to use that information with Cutadapt, we showhow to trim TruSeq adapters. The document gives the adapter sequencefor read 1 as AGATCGGAAGAGCACACGTCTGAACTCCAGTCA and for read 2as AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT. When using Cutadapt, thismeans you should trim your paired-end data as follows:

Numerous MSBuild properties are available to fine tune trimming, which is a feature that trims unused code from self-contained deployments. These options are discussed in detail at Trimming options. The following table provides a quick reference.

The TrimmerRootAssembly item lets you exclude an assembly from trimming. Trimming is the process of removing unused parts of the runtime from a packaged application. In some cases, trimming might incorrectly remove required references.

As first observed by GM Authority, the 2022 Trail Boss' base engine is now the 2.7, which powers several other trims and cab-body combinations, as outlined on the 2022 Silverado's product page. Unlike the 2021 Silverado, whose extended-cab model was available with the Custom Trail Boss trim, the 2022 Trail Boss is now exclusive to the crew cab and has had its engine options significantly revised.

The 2.7 will stand in for the Trail Boss's previous base engine, Chevy's 4.3-liter V6, whose 285 horsepower and 305 pound-feet of torque are bested by the 2.7's 310 and 420 respectively. A Chevy spokesperson confirmed to us that while GM hasn't yet updated its online configurator to reflect 2022's full roster of changes, the 2.7 will indeed power both the lower Custom Trail Boss and upper LT Trail Boss trims. 041b061a72